Please help me pay for Eva’s Surgery!

paypal.me/momoprime

Hi guys,

Those of you who have followed me for a while know that I have two cats, Banshee and Eva. Today I’ve made the difficult decision to ask for help paying for my support animal’s surgery.

While I love Banshee, Eva’s been with me through the worst parts of my life. She was with me through a long abusive relationship, my grandmother’s death, my aunt and uncle’s deaths, a mental health diagnosis, a stint teaching in Korea that turned into more of a visa-hostage and unpaid labour situation, and a very recent breast cancer scare. She’s been there for me when I had no one else and I’m terrified of losing her.

Eva’s had a growing lesion on her gums for a few years now, making grooming, eating, and sleeping increasingly difficult. When I initially had it assessed back in 2018, the vet clinic quoted me $1,800 plus additional costs. I, as a student, had no way of paying for this and had to put it to the side. But now it’s getting worse and she’s in constant pain. 

Photo of Eva’s mouth below this, scroll to the asterix to avoid it if you need to.

******************************************************************

The vet explained that the condition she has is called Tooth Resorption (https://www.vet.cornell.edu/departments-centers-and-institutes/cornell-feline-health-center/health-information/feline-health-topics/tooth-resorption). She explained that the only thing that can be done is the removal of the effected tooth, and possibly the removal of all teeth. She seems to think that all of them will need to be removed. The estimate provided to me by the vet was between $1,163.90 and $1,586.09 CAD not including a pre-anesthesia blood draw which would add another $200 to the bill.

I’ve blacked out personal information because Eva was seen under my parents’ account and they live in a very small town.

Because of COVID I’m not able to work as much as I would usually, and even with saving everything I do get (from work and the government) this surgery will more or less wipe out my savings and make it difficult to pay rent.

If you can donate anything at all to put towards covering The cost of Eva’s surgery I would be beyond grateful. And if you can’t or don’t want to donate I definitely understand, but hope you wouldn’t mind boosting this.

If you are willing to donate my paypal is  paypal.me/momoprime

I hope I’m not asking too much, and thank you for even stopping to read this.

May the fluff be with you.

Hot daddy suit on!

Vintage victorian mens neck ties

Only Aziraphale could think that angry Crowley is cute

Can we talk about how Aziraphale looked mildly interested when Crowley slammed him against the wall here 

His eyes shifted down a little, what’s on your mind, Aziraphale?

And when the nun lady appeared, “break up” their “intimate moment” Upon her voice, Crowley turned to look right away while this bastard angel was still too busy enjoying himself, he was totally unfazed

*Stares*

*Stare intensifies* “ aww bby you’re so dreamy heaven can’t compare”

And after like two beats, he finally *registered* the interrupting sound and graced the source with his attention along with a mildly bored expression 

A little annoyed, actually * internally* “ HOW DARE YOU, LADY OVER THERE” 

AND BONUS : when Aziraphale scolded Crowley for paralyzing the nun, saying “ you didn’t have to do that”

his FACE

Very well, Aziraphale, very very well, priority set straight right. 

When a demon threatens you bodily but you know you’re 100% safe and he would never hurt you.

I'm deleting my blog tonight xx it's over

a crow is a mother

omg too cute

the way the dog so gently takes the treat makes me so happy

a family can be a crow parent with their cat and dog kids

reblog if you are a trans cyborg, you support trans cyborgs, or you just really hate Laura Ingraham

01000110011101010110001101101011001000000111010001110010011000010110111001110011011100000110100001101111011000100110010101110011

YOU hates terfs

ah yes, my favourite foreign language feel, “I know what all of those words mean individually but not together like that”

not to forget its twin “i know (roughly) what you’re saying, but what are those words?”

Plus the secret triplet “I managed to get your drift but I don’t know how to answer you”.

and its step-child “I understood the literal meaning of the sentence but it turns out you were making a pun that is completely obvious to native speakers and now I feel like an ignoramus”

boot up, Bitch

Hey Germany? Can we chat for a second about Krampus?

Because 99% of the time, I search the vintage images, I get this dear gentleman

In his little lederhosen outfit and probably tormenting a small child.

But can we also address this?

And this?

Get dressed up to call on your lady. Your pants don’t go with that jacket, Krampy.

How about this?

Smooch Christmas Satan

‘oh hey u found me’

He liked it, so he’s putting a RING ON IT.

What’s with all these ladies being down to clown with the goat man who beats the snot outta naughty kids? Monsterfucking as early as Pre-christanity or at least the 1800s.

Krampus’s Weakness: Pretty pretty girls

Bonus:

TFW you see some FOOL trying to mack on your gf

Bonus Bonus: Lady Krampus; she beats the snot outta guys. Christmas Time Femdom for everyone.

@filthy-alien-meat

If you’re from America, we have no room to talk considering how many songs we have about wanting to make out with Santa Claus.

@teradoration

I knew I loved Germany for a reason lol

I LOVE THIS about Krampus! There was this whole period in history where he had major pull on the ladies and it’s THE BEST and I want contemporary holiday cards featuring Demon Santa Boyfriend

Kevin should also probably have an actual slide to look at.

kevin, slide or not, we appreciate your effort. 

Support Kevin’s scientific endeavors.

dear tumblr friends…

to say that i’m “disappointed” by the recent puritan tumblr crack-down on nudity is an understatement. i’m crushed. for many years, while twitter, facebook, instragram and patreon became more and more tight-wound, i always found tumblr a safe haven to post my free & joyful naked art and photos. 

i don’t know what kind of world we are coming to - in 2018 - when the naked female body really causes so much distress because people are so afraid of the power it represents.

i was so, so, so excited to post my non-censored album cover here today.

i’ve been working on this album, which is titled THERE WILL BE NO INTERMISSION - for six years, and the album cover, which is full frontal, wasn’t chosen randomly. i knew i’d have to censor it in certain places.

since my last album came out in 2012 (that was “theatre is evil”, my infamous kickstarter record), i’ve been through a lot. i did a TED talk, i wrote a best-selling boo, i had an abortion, i had a son, i moved to the woods, i lost my very best friend to cancer, i had a miscarriage on christmas day shortly after, i watched trump march into the white house, and then i watched brett kavanaugh march into the supreme court.

but all this time, women were marching. louder and louder. i watched women all over the globe light fires in one another’s hearts and brains. i watched women step up and bravely, shamelessly, graphically tell their truths. 

THIS IS WHAT IS HAPPENING RIGHT NOW.

when women are brave and shameless, we are unstoppable.

i am shameless.

i have no shame.

when did that become an insult, to be “shameless”?

WHO WANTS SHAME?

FUCK SHAME.

this record contains 10 of the most honest, vulnerable, funny, sad, dark, and (definitely) shameless songs i’ve ever written. the production is drum-tight, with very few drums: it’s mostly piano and ukulele with a smattering of other instruments, but it’s raw AF.

you can see the full cover, order the record, get tour tickets, etc, here on my website. the first single i dropped is also up there. go listen. the full album drops march 8th and the US/CANADA tour is on sale now.

https://nointermission.amandapalmer.net/

i love you all.

go forth in shamelessness.

The Change is coming.

x

a

p.s. photo by allan amato, in front of the saltan sea, los angeles. 

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

You got like six unique nucleotides so nice

OP is a virus from outer space

FUCK YOU OP