Wibbles and Wobbles

@wobblegong / wobblegong.tumblr.com

I'm pretty sure I don't know what I'm doing.
Avatar
reblogged

the saddest thing about the Fallout 76 fiasco for me, following it, is that ESO is a good game

it’s not my favorite Elder Scrolls, but it’s one of the better MMOs I’ve played, and they executed the Elder Scrolls components of it very well

they had the proven capacity to make/outsource a good MMO game and they failed

Avatar
wobblegong

Bethesda wanted to be the ones making it, borrowed the tech/ect talent from their sister studios (such as ZOS, the studio that did ESO) to help them do it and then ignored all feedback/advice they got. =)

Bethesda has not pulled a 2018-Blizzcon-Blizzard (yet?) but unless there’s some major changes I really worry about their hubris.

Avatar

It’s been a pleasure.

https://wobblegong.dreamwidth.org/

https://www.furaffinity.net/user/wobblegong/

I deleted my one sideblog and I don't expect to return, barring some massive 180 on corporate's part. (Massive-massive.) I’ll miss my friends and my shitposts but I’ll always carry you folks in my heart. (Or, y’know, poke me on Dreamwidth if you need to get in contact with me.)

Avatar
Avatar
curriebelle

Where Law and Chaos Came From: a D&D History Lesson

I’ve seen a few interesting posts about Dungeons and Dragons alignments that all share two interesting commonalities:

1) They think the two-axis system of Law vs Chaos and Good vs Evil is too restrictive for people who like to roleplay. 2) They try to redeem the two-axis system by redefining Law and Chaos in ways that make sense to them personally.

Good and Evil aren’t usually a topic of debate on these posts - it’s easy enough to play a character as generally doing the right thing or as being a total bastard. Discussion on acts of more debatable morality (e.g. torturing a villain for vital information, killing an innocent person by accident, sacrificing one for the good of all) tends to veer towards whether the action itself qualifies as good or evil, and not whether good and evil themselves need to be redefined. Conversely, I’ve seen Law and Chaos rewritten as Community vs Individuality, Tradition vs Cultural Mutability, Authority vs Anarchy - all interesting ideas that tend to reflect more on the person writing them than the actual purpose of the Law vs Chaos axis.

I’m not saying these people are wrong, but that these players (as well as the fine folks who wrote the 5e Handbooks) are placing too much significance on the purpose or intention of Law vs Chaos. The historical secret is that Law vs Chaos alignment never had any deep meaning behind it - or, at least, it never had any meaning deeper than the Pittsburgh Penguins versus the Vancouver Canucks.

I’ll explain how, but it requires a bit of a history lesson. The idea of Lawful and Chaotic alignments - as well as a number of other cornerstones of Dungeons and Dragons - came from a different game: a miniature wargame called Chainmail. It’s time for a deep dive.

Ahh, I’ve been looking for this essay again FOREVER

Hunh.  I’d always assumed the Law v. Chaos stuff was from Michael Moorcock’s  Elric of Melniboné and other Eternal Champion stories.

So, it IS though. @curriebelle explains how the alignments functioned in Chainmail, but not where those concepts came from, which was *almost certainly* the Eternal Champion stories. That’s why Chaotic Neutral is explained as an alignment of pure randomness – because in Moorcock, Law and Chaos weren’t human concepts, but rather unknowable cosmic forces. Most of Moorcock’s heroes are on the side of Law, not because Law is better (in fact, in the Corum books, the gods of Law are pretty explicitly shown to also be assholes), but because the predictablity and stability of Law isn’t as dangerous for human life. On the flip side, Jerry Cornelius is a hero of Chaos in a world gone too far over to Law, and is imho the quintessential depiction of what Chaotic Neutral *is* (seriously, just read the wiki entry: https://en.m.wikipedia.org/wiki/Jerry_Cornelius)

Thing is, Gygax’s understanding of Moorcock’s ideas is… limited, at best, and he reduces it to a boring and kinda racist Nature & Tribal Barbarism (chaos) vs Civilization (Law) nonsense. That’s why Gygax’s Elves are Lawful; they represent Proper Western Civilization. You CAN get that feeling from Moorcock, IF you’d only read his Dorian Hawkmoon & Elric stuff (which tbh was all that was out at the time! Moorcock was a new, hip, edgy dude on the scene in 1971, upending the more traditional notions of fantasy with Weird Shit). But it’s basically the postmodernist problem of continued interpretation and reinterpretation: Gygax’s model was already a simplified version of Moorcock’s, in turn misinterpreted by other people.

*deep breath* Also, @curriebelle ’s take on the Xaosciects in Planescape: Torment is unfair and doesn’t examine the entire situation. Planescape the pre-existing campaign setting was literally designed to examine D&D alignment and take it to its furthest, most absurdist conclusions. To go whole hog and ask, “if we take two axis alignment completely seriously and use it as the cosmological underpinnings of a universe, how does that look..?” It goes back to the Moorcockian ideas of these versions of Law and Chaos being *very much beyond petty mortal understanding*, and asks what does a universe where that is true look like? Which is how we get Absolute Law represented by dice-shaped robots, and Absolute Chaos by giant parasitic carnivorous rainbow frogs. The Xaosciects represent what happens when mortals try to understand absolute chaos and to live under its’ precepts: *it’s not meant for us.* Similarly, the Mercykillers represent what happens when we try to adhere to absolute law with no concern for silly mortal stuff. Planescape at its best is D&D interrogating its own alignment system; at the time of publication, 20 years worth of players and GMs wrestling with it and trying for their own interpretations. And, notably, Planescape’s titular planes actually have seventeen gradients/interpretations of the alignment system, ranging from law-as-just-blind-rules to law-as-civilization to chaos-as-madness to chaos-as-a-state-of-nature. Planescape offers no absolute answers, but at its best is a neat interrogation of all this nonsense.

This is a great addition! I’ll admit, I hadn’t heard of Moorcock before this, so it’s neat to learn about.

I think you’re close when you say it’s a problem of reinterpretation (although I wouldn’t agree it’s postmodern - to get postmodernism you either have to use the reference in an ironic way or juxtapose it with something else. This is just someone misunderstanding what they’re referencing). Gygax used Moorcock’s morality for Chainmail and oversimplified, and then because he oversimplified it, he misused it in D&D.

If Law and Chaos are “not meant for mortals” as you put it, but are meant to be more nebulous overarching godly concepts beyond our understanding, then I think you’ve made my main point better than I did: that Law and Chaos are pretty poor concepts to guide mere mortals in their roleplaying! They’re philosophical discussions beyond the scope of the table - depending on the table. It doesn’t help that Gygax defines the terms so sloppily. D&D IS a separate entity from Moorcock and even from Chainmail. He can’t expect all players to have read the work he’s clumsily referencing, and Gygax’s own definitions are truly, truly garbage. If he’d understood his own nine-category morality then Planescape wouldn’t need seventeen categories to explore it properly, you see?

Planescape does seem to be the exception to the rule, though - I’m glad there’s some self-awareness of the awkwardness of the D&D moral system - but I find some of Planescape’s “explorations” more interesting than others. The association of chaos with gender non-conformity is an interesting one, which I think deserves a lot more prodding. Associating gender fluidity with chaos implicitly associates rigid gender roles with law. That’s an essay right there.

On the other hand I find the definition of Chaos as “gibbering madness because We Cannot Understand Chaos’s True Nature” to be tedious. “What is chaos?” “Well, if you know, you’ll go mad.” Okay, well, then what is there to discuss? That’s why I’m not so hot on the Xaosciects. Nonsense is the end of the conversation.

Avatar
wobblegong

Oh sweet baby– thank you SO MUCH for finally explaining the rabbit hole that led to the D&D Alignment System, which I 100% admit up front is, imo, an absolutely terrible thing that I want to stake through its withered heart.

Avatar

If we’re being charitable I have cleaned a fifth of my boxes.

Why did I put this off for a week.

aaaaaaaaaaa

Upside, I have my very first perfect-IV pokemon: my first Magmar! (Downside, I don’t care about Magmar and I don’t think it’s a meta golden child either, but still! My first!)

Avatar
reblogged
Avatar
curlicuecal

that is no moon

i dont know what you guys are talking about, this is clearly just a normal Heart Ball Egg

the picture on the right gives me major flashdance vibes

Avatar
wobblegong

The most distressing part of looking at this post– besides learning that Truck Nuts are mutating and moving into new ecological niches– was the sudden impulse to Buy Some because I’m looking for some kind of light/reflective thing to adorn myself with for my nightly walks.

I guess the advantage if I bought these would be any jokes referring to my nuts would no longer need to be metaphorical. There’s also the (admittedly myriad) advantages of testicles that are made of silicone, act as a light source, and can be hung from whatever I want. Gosh, I’m tempted to get some just to make all the AMAB folk jealous of my superior cyborg nuts.

Avatar
reblogged
Avatar
wobblegong

My dearest Toastiness,

sdlanqaaws 6 pokeballs thank you!!

ps. what the HELL landmarks are you visiting, I was not prepared for the postcard on your gift. I love it. xD

Local ones! XD My small town has a very strong dedication to “cultural landmarks” and public art as part of its attempts to revitalize downtown, and a very dedicated Ingress player or two who apparently got every single one of those added to the map Niantic eventually ended up using for Pokestops. (Plus the churches, of course, since I’m in the south.) There’s a great little walking loop that takes me past a whole bunch of them in one twenty-minute go.

(I don’t remember, but now I’m curious–did I send you the masonic lodge, or one of the weird statues?)

That’s... very cool, actually! (And I salute the Ingress player(s) as well.)

One of the weird statues. “Please Don’t Feed the Artwork”. I was not prepared.

Avatar

HOHMAHGOH I FINALLY CAUGHT A SHROOMISH!!!

And... did my good deed for the day? There was a car stranded in the church parking lot, I eventually got close enough for the driver to go “yo I’m out of gas, but I have a portable tank, but I can’t figure out how to work the nozzle” and I flailed at it until I lucked into how it worked.

Downside, my preferred jacket is now at the dry cleaner’s on account of EXTENSIVE GASOLINE STAINS and my gloves are ditto except at home where I can hand wash them.

“Going Outside Sometimes” is wild and I don’t know if I missed it but I also don’t think I’m displeased.

ps. swept a six-empty-hearts gym, fingers crossed Team Yellow lets my plush manta bb hold it for eight hours. Nevermind, the rest of Team Red heard there were opening and hustled the hell over. 886 Mantine is the weakest thing in the gym now and I expect we'll hold it awhile! <_<

Avatar

I’m lazy and I don’t have all my clothes because they’re in the wash (because clothes have to be washed eventually, me!) but the sun has more than five minutes left and that’d be a really nice chance to hit the corner gyms.

Conversely, I could Not™ and remain warmer, more comfortable, and get chores done faster-better-more efficiently.

I should really stay home and do chores, noooo.

Avatar

I am my own ride but MOOD, BIG MOOD. “Oh look... I need to go grocery shopping... let me just casually add 90 minutes to the errand so I cAN SPIN STOPS!!” And then there’s an entire subreddit of people discussing the PROBLEM of auto-spin/catch peripherals working too well and clogging up their inventories with Pokemon/items and needed tending twice a day. @_@

ps. The pokeball drought is real.

1. This is EXACTLY who I thought would make this comment.

2. I’m actually enjoying it so much! Turns out my janky meatsack figures out how to thermoregulate once I’m briskly walking so I’m more comfortable 45 min into the walk than I am sitting around at home!

Now I’m worried about playing during the warmer months of the year. ;_; Will I buy workout clothes just so I have garments to sweat all over by June? Eww.

Avatar
Avatar
mwg-drwg

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

Avatar
monkeysky

You got like six unique nucleotides so nice

Image

OP is a virus from outer space

Image

FUCK YOU OP

You are using an unsupported browser and things might not work as intended. Please make sure you're using the latest version of Chrome, Firefox, Safari, or Edge.